Prostate Cancer Stem Cells

Sample details Pages: 24 Words: 7277 Downloads: 8 Date added: 2017/06/26 Category Statistics Essay Did you like this example? Characterisation of prostate cancer stem cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Don’t waste time! Our writers will create an original "Prostate Cancer Stem Cells | Sciences Dissertations" essay for you Create order Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 2024 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin 21. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20g/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70C and thawed at 37c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600l of RLT Plus (10l of -mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700l of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 l of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 l of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 l of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturers instruction 2 l (2 g) of previously prepared RNA was added to 1l of 50uM oligo (dT)20, 1l of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 l. The reaction tube was incubated at 65C for 5 mins and then placed on ice for one min. In another tube 2 l of 10X RT buffer, 4l of 25mM Mgcl2, 2 l of 0.1DTT, 1 l of RNaseOUTTM (40U/ l) and 1 l of SuperScriptTM III RT (200 U/ l) was added. The 10 l mix of the first tube was added to the second tube and incubated for 50 mins at 50C. The reaction was terminated by incubating at 85C for 5mins and then chilled on ice. 1 l of RNase H was added to the tube and incubated for 20 mins at 37C. The total yield of cDNA was 25 l and this was stored at -20C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 l of 10xPCR buffer II, 3 or 6 l of 25mM MgCl2, 4 l of 10mM dNTP, 1 l of forward and reverse primer at 10 M and 0.25 l of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/l was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94C for 6 min, and then 35 cycles of 94C for 30 secs, 55C for 30 secs, 68C for 30 secs, 72C for 30 secs followed by 72C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: A reporter dye (6-FAM) linked to the 5 end of the probe. A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 end of the probe 5 Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 end and a quencher dye at the 3 end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 l of final volume of TaqMan mix was placed. The mixture included 5l of TaqMan Gene Expression Assay, 0.5 l of the primer, 0.5 l of GAPDH (endogenous Control) and 4 l of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50C for 2 min, followed by 95C for 10 mins. Then 40 cycles of 95C for 15 secs and 60C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/l versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/l for C42B and 190ng/l for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ l, 5ng/l, 20ng/ l and 50ng/ l) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/l, 5 l, 20 l and 50 l . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH Ct Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the Ct value was calculated from the standard curve. d. Relative quantification or fold changes. Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore Ct is calculated by subtracting the Ct value of the adherent cells from the Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the Ct method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, 21 integrin, Sca-1 and -catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. -catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high expression in the prostasphere and this has been reported in published papers. However in my analysis, (Fig 8N and Fig 8O) shows absences of CD44 expression in both LNCaP and C42B prostasphere although it was possible to construct the standard curve for CD44 with DU145 (figure 8i). Previous studies have provided evidence of reduced expression of CD44 in LNCaP and C42B cell lines. This is probably been reflected in this study. Immunoflourescence done by Dr Prowse (Figure.4C i-vi) described the effect of Wnt3a on keratin 18, CD44 and ABCG2. Their findings were increase of expression of CD44 on Wnt3a treated spheres. Keratin 18 is present in most adenocarcinomas. Levels of K18 increases dramatically in prostosphere but interestingly it is more so when treated with Wnt3a (Figure 8 J). Immunflourescence (Figure 4 I, ii) of K18 shows similar effects (10). This might suggest WNT signalling may promote cell renewal and differentiation (42, 43). Similarly in case of ABCG2 Dr Prowse provided data of immunoflourescence that showed increase in 40% of LNCaP spheres, and 100% in C4-2B spheres. ABCG2 is a haematopoietic marker expressed in variety of stem cells (44). My study shows similar results. Another promising marker c-kit/CD117 has not been fully explored. In murine prostate studies have showed CD117 maybe responsible for self renewal and is capable of regeneration of functional and secretion producing prostate when transplanted in vivo (14). My analysis shows increase in expression in prostasphere with reduced expression in treated samples. This finding seems to be promising although further studies are required. BMI-1 is responsible for proliferation and self renewal capacity and PSA promotes differentiation. Studies have provided evidence of increased expression of BMI-1 and PSA in stem cells. However mRNA expression of these two markers failed to show significant changes. Characterisation and identification of stem cells are very challenging. For proper characterisation specific markers are needed to be identified. In both cell lines C42B and LNCaP Keratin 18 shows the most fold change in expression. Intermediate cells have limited capacity of proliferation and they can differentiate into luminal cells and neuroendocrine cells. Neuroendocrine cells are non proliferative. However the luminal cells have the proliferation capacity. Keratin 18 is a luminal marker and its high expression suggests the luminal cells can proliferate into cells with stem like characteristics. Another interesting marker ABCG2 shows positive fold change. Studies (46) have provided evidence of a subpopulation of ABCG2+/AR-cells that are capable of isolating cancer stem cells by efflux of androgens. ABCG2 is a haemopoietic marker and is responsible for survival of cells. Furthermore Patrawala et al 2005 provides that ABCG2- cells are capable of generating ABCG2+ cells in large clones. Increase of expression of ABCG2 in the QPCR analysis may suggest in hypoxic conditions cells are able to survive and are rapid progenitors (45). My quantitative analysis of the ten markers provides preliminary data of the heterogenecity of prostate cancer cells with stem like characteristics. However it should be kept in mind that the profile of markers may change according to the site of origin and maturity of the stem cells. Overall my datas are very promising but they are at the preliminary stage. In my study I did not replicate the experiments three times which is very much required for validation. Furthermore I have looked in two cell lines and experiments should be conducted for the other cell lines as well. The other things to consider are the shortcomings of the Q-PCR method. A number of variabilities such as RNA degradation, data analysis can change the result. Future direction of work would be addressing the above limitations and exploration of its potential in diagnostic settings. References: Cancer Research UK. 2. Charles Huggins S. Endocrine-induced regression of cancers Nobel Lecture, December 13, 1966. 3. Petrylak DP, Tangen CM, Hussain MH, Lara PN Jr., Jones JA, Taplin ME, Burch PA, Berry D, Moinpour C, Kohli M, Benson MC, Small EJ, Raghavan D, Crawford ED: Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004, 351 (15):1513-1520. 4. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310: 644648. 5. The cancer stem cell hypothesis: in search of definitions,markers, and relevance Michail Shipitsin and Kornelia Polyak Laboratory Investigation (2008) 88, 459463). 6. Breast cancer stem cells: implications for therapy of breast cancer. Morrison BJ, Schmidt CW, Lakhani SR, Reynolds BA, Lopez JA. Breast Cancer Res. 2008;10(4):210. 7. Abate-Shen, and Shen, M.M. 2000. Molecular genetics of prostate cancer. Genes Dev. 14:24102434) 8. What is apoptosis, and why is it important? Renehan AG, Booth C, Potten CS. BMJ. 2001 Jun 23;322(7301):1536-8 9. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10(12):901-9. 10. WNT signaling regulates self renewal and differentiation of prostate cancer cells with stem cell characteristics. Isabelle Bisson, David M Prowse. Cell Research (2009) :1-15. 11. De Marzo MA, Nelson WG, Meeker AK, Coffey DS: Stem cell features of benign and malignant prostate epithelial cells. J Urol 1998. 12. Matthew Bui and Robert E. Reiter Cancer and Metastasis Reviews 17: 391399, 1999). 13.Xin L, Lukacs RU, Lawson DA, Cheng D, Witte ON. Selfrenewal and multilineage differentiation in vitro from murine prostate stem cells. Stem Cells 2007; 25:2760-2769. 14. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell. Nature 2008; 456:804- 808). 15.Hudson DL, OHare M, Watt FM, Masters JR. Proliferative heterogeneity in the human prostate: evidence for epithelial stem cells. Lab Invest 2000; 80:1243-1250. 16. Hudson DL, Guy AT, Fry P, et al. Epithelial cell differentiation pathways in the human prostate: identification of intermediate phenotypes by keratin expression. J Histochem Cytochem 2001; 49:271-278. 17. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression. J Cell Sci 2001; 114:3865-3872. 18. Litvinov IV, Vander Griend DJ, Xu Y, et al. Low-calcium serum-free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res 2006; 66:8598-8607. 19. Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. English HF, Santen RJ, Isaacs JT. Prostate. 1987;11(3):229-42. 20. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L, Tang DG. Oncogene. 2006 Mar 16;25(12):1696-708. 21.Collins AT, Berry PA, Hyde C, et al. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 2005; 65:10946-10951. 22. van Bokhoven A, Varella-Garcia M, Korch C, et al. Molecular characterization of human prostate carcinoma cell lines. Prostate 2003; 57:205-225 23. A distinct side population of cells with high drug efflux capacity in human tumor cells. Hirschmann-Jax C, Foster AE, Wulf GG, Nuchtern JG, Jax TW, Gobel U, Goodell MA, Brenner MK. Proc Natl Acad Sci U S A. 2004 Sep 28;101(39):14228-33. 24. Partial contribution of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/TRAIL receptor pathway to antitumor effects of interferon-alpha/5-fluorouracil against Hepatocellular Carcinoma. Yamamoto T, Nagano H, Sakon M, Wada H, Eguchi H, Kondo M, Damdinsuren B, Ota H, Nakamura M, Wada H, Marubashi S, Miyamoto A, Dono K, Umeshita K, Nakamori S, Yagita H, Monden M. Clin Cancer Res. 2004 Dec 1;10(23):7884-95. 25. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10 (12):901-9. 26. Applied biosystem. 27. Identification, Characterization, and Differentiation of Human Prostate Cells.Parmender P. Mehta, Carlos Perez-Stable, Bernard A. Roos, Mehrdad Nadji Methods in Molecular Biology.Vol:137Jan-21-200: 317-335 28. Unopposed c-MYC expression in benign prostatic epithelium causes a cancer phenotype. Williams K, Fernandez S, Stien X, Ishii K, Love HD, Lau YF, Roberts RL, Hayward SW. Prostate. 2005 Jun 1;63(4):369-84. 29. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on a2h1-integrin expression. J Cell Sci 2001;114:386572. 30. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ, Collins AT. CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci 2004;117: 353945. 31.Kleeberger, Wolfram, Bova, G. Steven, Nielsen, Matthew E., Herawi, Mehsati, Chuang, Ai-Ying, Epstein, Jonathan I., Berman, David M. Roles for the Stem Cell Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis Cancer Res 2007 67: 9199-9206. 32. Anchorage-independent culture maintains prostate stem cells. Shi X, Gipp J, Bushman W. Dev Biol. 2007 Dec 1;312(1):396-406. Epub 2007 Sep 29). 33. Oct-4: gatekeeper in the beginnings of mammalian development. Pesce M, Schler HR.Stem Cells. 2001;19(4):271-8. 34. Glycoconjugate expression during embryogenesis and its biological significance. Bruce A. Fenderson, E. M. Eddy, Sen-Itiroh Hakomori.BioEssays Volume12, Issue4, Date:April 1990, Pages:173-179 35. Bonkhoff, H, Remgerger, K (1996). Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: a stem cell model. Prostate 28:98-106. 36. Patrawala L, Calhoun-Davis T, Schneider-Broussard R, Tang DG. Hierarchical organization of prostate cancer cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells. Cancer Res 2007; 67:6796- 6805. 37. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL. CD44+ CD24(-) prostate cells are early cancer progenitor/ stem cells that provide a model for patients with poor prognosis. Br J Cancer 2008; 98:756-765. 38. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of cultured human prostate cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urol Res 1997;3:6775. 39. Farini D, Puglianiello A, Mammi C, Siracusa G, Moretti C. Dual effect of pituitary adenylate cyclase activating polypeptide on prostate tumor LNCaP cells: short- and long-term exposure affect proliferation and neuroendocrine differentiation. Endocrinology 2003;144: 163143. 40. Jensen JB, Parmar M. Strengths and limitations of the neurosphere culture system. Mol Neurobiol 2006;34:153161. 41. Collins, Anne T., Berry, Paul A., Hyde, Catherine, Stower, Michael J., Maitland, Norman Prospective Identification of Tumorigenic Prostate Cancer Stem Cells Cancer Res 2005 65: 10946-10951. 42.Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127:469-480. moment. J Pathol 2008; 214:3-9. 43.Lo Celso C, Prowse DM, Watt FM. Transient activation of beta-catenin signalling in adult mouse epidermis is sufficient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours. Development 2004; 131:1787-1799. 44. Sheng Zhou, John D. Schuetz, Kevin D. Bunting, Anne-Marie Colapietro, Janardhan Sampath, John J. Morris, Irina Lagutina, Gerard C. Grosveld, Mitsujiro Osawa, Hiromitsu Nakauchi Brian P. Sorrentino . The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype, Nature Medicine 7, 1028 1034 (2001). 45. L. Patrawala, T. Calhoun and R. Schneider-Broussard et al., Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2 cancer cells are similarly tumorigenic, Cancer Res 65 (2005), pp. 62076219. 46. W.J. Huss, D.R. Gray and N.M. Greenberg et al., Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells, Cancer Res 65 (2005), pp. 66406650. Appendix Protocols and Supporting documents Protocol: Purification of Total RNA from Animal Cells This protocol requires the RNeasy Mini Kit. Determining the correct amount of starting material It is essential to use the correct amount of starting material in order to obtain optimal RNA yield and purity. The minimum amount is generally 100 cells, while the maximum amount depends on: The RNA content of the cell type The RNA binding capacity of the RNeasy spin column (100 g RNA) The volume of Buffer RLT required for efficient lysis (the maximum volume of Buffer RLT that can be used limits the maximum amount of starting material to 1 x 107 cells) RNA content can vary greatly between cell types. The following examples illustrate how to determine the maximum amount of starting material: COS cells have high RNA content (approximately 35 g RNA per 106 cells). Do not use more than 3 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. HeLa cells have average RNA content (approximately 15 g RNA per 106 cells). Do not use more than 7 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. NIH/3T3 cells have low RNA content (approximately 10 g RNA per 106 cells). The maximum amount of starting material (1 x 107 cells) can be used. If processing a cell type not listed and if there is no information about its RNA content, we recommend starting with no more than 34 x 106 cells. Depending on RNA yield and purity, it may be possible to increase the cell number in subsequent preparations. Do not overload the RNeasy spin column, as this will significantly reduce RNA yield and purity. Counting cells is the most accurate way to quantitate the amount of starting material. As a guide, the number of HeLa cells obtained in various culture vessels after confluent growth is given in Table 5 SuperScriptTM III First Stand Synthesis System for RT-PCR Amplification of Target cDNA The first-strand cDNA obtained in the synthesis reaction may be amplified directly using PCR. We recommend using 10% of the first-strand reaction (2 l) for PCR. However, for some targets, increasing the amount of firststrand reaction up to 10 l in PCR may result in increased product yield. We recommend the following DNA polymerases (for ordering information, : Platinum Taq DNA Polymerase provides automatic hot-start conditions for increased specificity and sensitivity. It is recommended for targets up to 4 kb. Platinum Taq DNA Polymerase High Fidelity provides increased fidelity and higher yields for targets up to 15 kb. Platinum Pfx DNA Polymerase possesses a proofreading 3 to 5exonuclease activity and provides maximum fidelity for PCR. It is recommended for targets up to 12 kb. Protocol for DNA Amplification A Master mix of reagents (water, dNTPs, Primers and Enzymes) for all samples can be prepared fast and then aliquoted to individual tubes. Magnesium chloride and the template DNA are then added. Using such mixes would reduce pipetting loss, increase accuracy and reduce the number of transfers. Perform Amplification in Applied Biosystem PCR tube. DNA may stick to the plastic and since the nuclease are found on the surfaces sterile siliconized tubes and tips are used.