Monday, August 24, 2020
HRD Research Paper Example | Topics and Well Written Essays - 1250 words
HRD - Research Paper Example This paper tries to give a blend of scholastic/insightful writing composed on work-life activity, and give a writing survey on the work-life activity. This paper will concentrate on eldercare as a work-life activity. Generally, old consideration is a duty of individuals from a family, and is given in the homes of the more distant family. Be that as it may, in present day states, care for the old is given by beneficent organizations or state. This is because of the diminishing size of families, topographical scattering of families, more noteworthy future, and inclination of ladies to work outside homes and access to instruction. Different nations give varying types of old consideration, quickly evolving. This is on the grounds that there are different provincial contrasts in regards to dealing with the old. It has been noticed that comprehensively that older consideration devour greater part of wellbeing consumptions contrasted with other age gatherings. Expanding huge extent of the o ld has likewise been represented all around (Petterson, Donnersvard, Lagerstrom and Toomingas, 2006). In the vast majority of the western nations, offices of old consideration are inside private family care homes, proceeding with care retirement networks, nursing homes, and detached helped living offices. These offices have administrative and bolster staff that give board and room, restoration administrations, and individual consideration in a family domain. Proof shows that eldercare programs are a consideration administration that gives free, classified help to senior residents: the older. The projects offer a wide scope of administrations including educational talks and workshops; private, free directing, evaluation, conference, and referral to both significant distance and nearby offices; and occasional gathering gatherings with parental figure support (Denton, 2012). There are various advantages of eldercare activities relying upon various nations. Be that as it may, in most we stern countries, senior residents get government disability and eldercare benefits. Government managed savings and Medicare are long haul benefits that the old get. Accepting such advantages frequently start at 65 and proceed til' the very end. This is quite a while approach paid out in numerous years (Ansah, Matchar, Love, Malhotra, Chan and Eberlein, 2013). Eldercare administrations are typically paid for by the common laborers. Cash is removed from each check until the retirement age when such individuals start to get cash each month to make due on. Senior residents make most of those getting government managed savings. This is named as senior consideration advantage and advantages individuals who satisfy the certified age to get it. Long haul eldercare is an alleviation to the number of inhabitants in senior residents as it goes on for a considerable length of time of getting regularly scheduled installment to live on. Nonetheless, government has an approach to guarantee recipie nts fit the bill for the advantages (Ansah, Matchar, Love, Malhotra, Chan and Eberlein, 2013). Aside from government managed savings, there are other long haul benefits that accompany the eldercare program. Projects like Medicare and Medicaid are accessible to the older at the period of retirement. These two projects supplement the eldercare program with open and reasonable wellbeing projects, and constrained co-pay. The projects help the older with a wide range of care they require to live and keep their places of living without
Saturday, August 22, 2020
Things They Carried By Tim O`Brien Essays - The Things They Carried
Things They Carried By Tim O'Brien Tim O'Brien's The Things They Carried is definitely not a novel about the Vietnam War. It is a tale about the officers and their encounters and feelings that are achieved from the war. O'Brien offers a few expressions about war through these dynamic characters. He shows the rough idea of warriors under the weights of war, he makes a compelling antiwar articulation, and he remarks on the inversion of a social deviation into the standard. By handily utilizing the complex method of explicit, cognizant detail choice and using suggestive phrasing, O'Brien altogether and convincingly comes to each meaningful conclusion. The fierce nature that the fighters procured during their visit in Vietnam is one of O'Brien's transcendent subjects in his novel. By deliberately choosing very graphic subtleties that uncover the radical change in way inside the men, O'Brien makes inside the peruser a comprehension of the impacts of war on its members. One of the officers, Norman Bowler, in any case an exceptionally delicate individual, conveyed a Thumb. . .The Thumb was dim earthy colored, rubbery to contact. . . It had been cut from a VC cadaver, a kid of fifteen or sixteen(13). Bowler had been an excellent natured individual in regular citizen life, yet war makes him into a very hard-mannered, genuinely destitute officer, conveying about a cut off finger as a trophy, pleased with his execute. The change appeared through Bowler is an fantastic marker of the mental and passionate change that the majority of the fighters experience. To bring a blameless youngster from touchy to unconcerned, from minding to disdainful, requires an incredible power; the war gives this power. Be that as it may, as often as possible are the progressions increasingly extreme. An officer named Ted Lavender embraced a stranded little dog. . .Azar lashed it to a Claymore people killing mine and pressed the terminating device(39). Azar has become sick; to execute a doggy that another person has embraced is shocking. Be that as it may, the punishment of viciousness has become the standard of conduct for these men; the brief snapshot of empathy appeared by one man is right away eradicated by another, slowing down request inside the gathering. O'Brien here shows a trace of affectability among the men to set up a frightening difference between the past and the present for these men. The impact created on the peruser by this difference is one of frightfulness; consequently satisfying O'Brien's motivation, to persuade the peruser of war's seriously negative impacts. In the wild ox story, We went over a child water wild ox. . .After dinner Rat Kiley went over and stroked its nose. . .He ventured back and shot it through the correct front knee. . .He shot it twice in the flanks. It wasn't to slaughter, it was to hurt(85). Rodent shows an extreme passionate issue here; be that as it may, it is as yet the standard. The alarming level of disconnected feeling welcomed on by the war is inalienable in O'Brien's definite records of the troopers' activities concerning the lives of different creatures. O'Brien's utilization of explicit and demonstrative lingual authority upgrades a similar topic, the loss of affectability and increment in rough conduct among the troopers. The VC from which Bowker took the thumb was only a boy(13), giving the picture of a youthful, honest individual who ought not have been exposed to the detestations of war. The meaning related with kid upgrades the way that executing has no enthusiastic impact on the Americans, that they murder for sport and couldn't care less who or what their game might be. Similarly as unreasonable as executing young men, however, is the executing of a baby(85), the meaning being related with human newborn children despite the fact that it is utilized to depict a youthful water wild ox they torment. The possibility of an infant is unique, and the slaughtering of one is disliked in present day society, paying little heed to species. O'Brien makes an disposition of disturb in the peruser with the word, further satisfying his motivation in censuring viciousness. Significantly progressively uncommon in implication to be murdered is the stranded puppy(39). Adding to the current thought of executing babies is killing stranded infants, which brings out anger inside the peruser. The entire idea is figurative, in view of the meanings of catchphrases; by and by, it is incredibly compelling in passing on O'Brien's subject. O'Brien makes a substantial, powerful antiwar explanation in The Things They Carried. The subtleties he incorporates give the peruser knowledge into his suppositions concerning the Vietnam War and the draft that was utilized to gather officers for the war. While considering running away to Canada, he says: I was drafted to battle a war I loathed.
Friday, July 17, 2020
Cardiac Patients Knowledge and Use of Sublingual Glyceryl Trinitrate Article
Cardiac Patients' Knowledge and Use of Sublingual Glyceryl Trinitrate Article Cardiac Patients' Knowledge and Use of Sublingual Glyceryl Trinitrate by Fan, Mitchell Cooke â€" Article Example > The paper “ Cardiac Patients’ Knowledge and Use of Sublingual Glyceryl Trinitrate by Fan, Mitchell Cooke †is a spectacular variant of an article on health sciences medicine. The research was to examine the knowledge and use of sublingual glyceryl trinitrate by cardiac patients. This is the main concern for clinical diagnosis since a third of all hospitalizations are as a result of the cardiac condition called the coronary heart disease who risk premature deaths, and vascular events like myocardial infarction (McIntosh 2004, pp. 272). The study was also to look at the patients' characteristics that influence their level of knowledge and use regarding SLGTN. This research was important for the nursing practice and cardiac rehabilitation staff in facilitating education sessions for patients in acute rehabilitation and admission situations regarding SLGTN. This way the role of nurses in providing health care and cardiac rehabilitation will be improved to promote quality of life and long term survival of patients (Warrington et al 2003, pp. 124). The research most specifically targets the cardiac patients who are administered SLGTN sprays and tablets in the study hospital. The patients are supposed to have knowledge of storage, angina prevention and the status of the drug expiry. Literature ReviewAccording to AIHW (2004), Coronary Heart Disease (CHD) is the most common heart disease in Australia has been the one with a third majority principal diagnosis for hospital admissions (ABS 2006). Angina has been found as a common symptom for CHD and can be managed by the patients using SLGTN as a pain control (Liu et al 2006, p. 1 out 2). The research shows that people with angina pain can manage their condition by self-administration of SLGTN to reduce complications. The research found more people with this condition wanted to know about its treatment, control, causes, medication, and its effects on their everyday life (Weetch 2003, pp. 152). This is because people didn’ t have enough knowledge of the use of SLGTN in appropriation and safe administration (McGovern et al 2001, pp. 175). However, this is as far as European and American research is concerned with no specific Australian research in the past that has looked at the patient’ s use and knowledge of SLG TN. Other studies for other medications like nitro-glycerine for angina showed that patients had little knowledge of its use and storage (Fernandez et al 2007, pp. 56). The past researches in Australia have not been specific to the knowledge of patients on the use of SLGTN and as a result, there is a research gap that needs to be filled which brings us to the aims of this research. The first is to research on the patients’ level of knowledge and use of SLGTN and also the patients’ characteristics that influence the use and the level of knowledge of SLGTN. Patients might not be able to administer the drug by themselves if they lack prior knowledge on how to given the risk involved in dosage. Type of patients also differ in knowledge and use of the drug and as a result the ability to administer it on themselves. Some characteristics are likely to encourage or hinder the use of the drug either by the health personnel or self-administration by the cardiac patients.
Thursday, May 21, 2020
Prostate Cancer Stem Cells
Sample details Pages: 24 Words: 7277 Downloads: 8 Date added: 2017/06/26 Category Statistics Essay Did you like this example? Characterisation of prostate cancer stem cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Don’t waste time! Our writers will create an original "Prostate Cancer Stem Cells | Sciences Dissertations" essay for you Create order Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 2024 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin 21. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20g/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70C and thawed at 37c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600l of RLT Plus (10l of -mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700l of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 l of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 l of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 l of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturers instruction 2 l (2 g) of previously prepared RNA was added to 1l of 50uM oligo (dT)20, 1l of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 l. The reaction tube was incubated at 65C for 5 mins and then placed on ice for one min. In another tube 2 l of 10X RT buffer, 4l of 25mM Mgcl2, 2 l of 0.1DTT, 1 l of RNaseOUTTM (40U/ l) and 1 l of SuperScriptTM III RT (200 U/ l) was added. The 10 l mix of the first tube was added to the second tube and incubated for 50 mins at 50C. The reaction was terminated by incubating at 85C for 5mins and then chilled on ice. 1 l of RNase H was added to the tube and incubated for 20 mins at 37C. The total yield of cDNA was 25 l and this was stored at -20C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 l of 10xPCR buffer II, 3 or 6 l of 25mM MgCl2, 4 l of 10mM dNTP, 1 l of forward and reverse primer at 10 M and 0.25 l of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/l was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94C for 6 min, and then 35 cycles of 94C for 30 secs, 55C for 30 secs, 68C for 30 secs, 72C for 30 secs followed by 72C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: A reporter dye (6-FAM) linked to the 5 end of the probe. A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 end of the probe 5 Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 end and a quencher dye at the 3 end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 l of final volume of TaqMan mix was placed. The mixture included 5l of TaqMan Gene Expression Assay, 0.5 l of the primer, 0.5 l of GAPDH (endogenous Control) and 4 l of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50C for 2 min, followed by 95C for 10 mins. Then 40 cycles of 95C for 15 secs and 60C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/l versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/l for C42B and 190ng/l for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ l, 5ng/l, 20ng/ l and 50ng/ l) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/l, 5 l, 20 l and 50 l . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH Ct Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the Ct value was calculated from the standard curve. d. Relative quantification or fold changes. Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore Ct is calculated by subtracting the Ct value of the adherent cells from the Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the Ct method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, 21 integrin, Sca-1 and -catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. -catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high expression in the prostasphere and this has been reported in published papers. However in my analysis, (Fig 8N and Fig 8O) shows absences of CD44 expression in both LNCaP and C42B prostasphere although it was possible to construct the standard curve for CD44 with DU145 (figure 8i). Previous studies have provided evidence of reduced expression of CD44 in LNCaP and C42B cell lines. This is probably been reflected in this study. Immunoflourescence done by Dr Prowse (Figure.4C i-vi) described the effect of Wnt3a on keratin 18, CD44 and ABCG2. Their findings were increase of expression of CD44 on Wnt3a treated spheres. Keratin 18 is present in most adenocarcinomas. Levels of K18 increases dramatically in prostosphere but interestingly it is more so when treated with Wnt3a (Figure 8 J). Immunflourescence (Figure 4 I, ii) of K18 shows similar effects (10). This might suggest WNT signalling may promote cell renewal and differentiation (42, 43). Similarly in case of ABCG2 Dr Prowse provided data of immunoflourescence that showed increase in 40% of LNCaP spheres, and 100% in C4-2B spheres. ABCG2 is a haematopoietic marker expressed in variety of stem cells (44). My study shows similar results. Another promising marker c-kit/CD117 has not been fully explored. In murine prostate studies have showed CD117 maybe responsible for self renewal and is capable of regeneration of functional and secretion producing prostate when transplanted in vivo (14). My analysis shows increase in expression in prostasphere with reduced expression in treated samples. This finding seems to be promising although further studies are required. BMI-1 is responsible for proliferation and self renewal capacity and PSA promotes differentiation. Studies have provided evidence of increased expression of BMI-1 and PSA in stem cells. However mRNA expression of these two markers failed to show significant changes. Characterisation and identification of stem cells are very challenging. For proper characterisation specific markers are needed to be identified. In both cell lines C42B and LNCaP Keratin 18 shows the most fold change in expression. Intermediate cells have limited capacity of proliferation and they can differentiate into luminal cells and neuroendocrine cells. Neuroendocrine cells are non proliferative. However the luminal cells have the proliferation capacity. Keratin 18 is a luminal marker and its high expression suggests the luminal cells can proliferate into cells with stem like characteristics. Another interesting marker ABCG2 shows positive fold change. Studies (46) have provided evidence of a subpopulation of ABCG2+/AR-cells that are capable of isolating cancer stem cells by efflux of androgens. ABCG2 is a haemopoietic marker and is responsible for survival of cells. Furthermore Patrawala et al 2005 provides that ABCG2- cells are capable of generating ABCG2+ cells in large clones. Increase of expression of ABCG2 in the QPCR analysis may suggest in hypoxic conditions cells are able to survive and are rapid progenitors (45). My quantitative analysis of the ten markers provides preliminary data of the heterogenecity of prostate cancer cells with stem like characteristics. However it should be kept in mind that the profile of markers may change according to the site of origin and maturity of the stem cells. Overall my datas are very promising but they are at the preliminary stage. In my study I did not replicate the experiments three times which is very much required for validation. Furthermore I have looked in two cell lines and experiments should be conducted for the other cell lines as well. The other things to consider are the shortcomings of the Q-PCR method. A number of variabilities such as RNA degradation, data analysis can change the result. Future direction of work would be addressing the above limitations and exploration of its potential in diagnostic settings. References: Cancer Research UK. 2. Charles Huggins S. Endocrine-induced regression of cancers Nobel Lecture, December 13, 1966. 3. Petrylak DP, Tangen CM, Hussain MH, Lara PN Jr., Jones JA, Taplin ME, Burch PA, Berry D, Moinpour C, Kohli M, Benson MC, Small EJ, Raghavan D, Crawford ED: Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004, 351 (15):1513-1520. 4. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310: 644648. 5. The cancer stem cell hypothesis: in search of definitions,markers, and relevance Michail Shipitsin and Kornelia Polyak Laboratory Investigation (2008) 88, 459463). 6. Breast cancer stem cells: implications for therapy of breast cancer. Morrison BJ, Schmidt CW, Lakhani SR, Reynolds BA, Lopez JA. Breast Cancer Res. 2008;10(4):210. 7. Abate-Shen, and Shen, M.M. 2000. Molecular genetics of prostate cancer. Genes Dev. 14:24102434) 8. What is apoptosis, and why is it important? Renehan AG, Booth C, Potten CS. BMJ. 2001 Jun 23;322(7301):1536-8 9. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10(12):901-9. 10. WNT signaling regulates self renewal and differentiation of prostate cancer cells with stem cell characteristics. Isabelle Bisson, David M Prowse. Cell Research (2009) :1-15. 11. De Marzo MA, Nelson WG, Meeker AK, Coffey DS: Stem cell features of benign and malignant prostate epithelial cells. J Urol 1998. 12. Matthew Bui and Robert E. Reiter Cancer and Metastasis Reviews 17: 391399, 1999). 13.Xin L, Lukacs RU, Lawson DA, Cheng D, Witte ON. Selfrenewal and multilineage differentiation in vitro from murine prostate stem cells. Stem Cells 2007; 25:2760-2769. 14. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell. Nature 2008; 456:804- 808). 15.Hudson DL, OHare M, Watt FM, Masters JR. Proliferative heterogeneity in the human prostate: evidence for epithelial stem cells. Lab Invest 2000; 80:1243-1250. 16. Hudson DL, Guy AT, Fry P, et al. Epithelial cell differentiation pathways in the human prostate: identification of intermediate phenotypes by keratin expression. J Histochem Cytochem 2001; 49:271-278. 17. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression. J Cell Sci 2001; 114:3865-3872. 18. Litvinov IV, Vander Griend DJ, Xu Y, et al. Low-calcium serum-free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res 2006; 66:8598-8607. 19. Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. English HF, Santen RJ, Isaacs JT. Prostate. 1987;11(3):229-42. 20. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L, Tang DG. Oncogene. 2006 Mar 16;25(12):1696-708. 21.Collins AT, Berry PA, Hyde C, et al. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 2005; 65:10946-10951. 22. van Bokhoven A, Varella-Garcia M, Korch C, et al. Molecular characterization of human prostate carcinoma cell lines. Prostate 2003; 57:205-225 23. A distinct side population of cells with high drug efflux capacity in human tumor cells. Hirschmann-Jax C, Foster AE, Wulf GG, Nuchtern JG, Jax TW, Gobel U, Goodell MA, Brenner MK. Proc Natl Acad Sci U S A. 2004 Sep 28;101(39):14228-33. 24. Partial contribution of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/TRAIL receptor pathway to antitumor effects of interferon-alpha/5-fluorouracil against Hepatocellular Carcinoma. Yamamoto T, Nagano H, Sakon M, Wada H, Eguchi H, Kondo M, Damdinsuren B, Ota H, Nakamura M, Wada H, Marubashi S, Miyamoto A, Dono K, Umeshita K, Nakamori S, Yagita H, Monden M. Clin Cancer Res. 2004 Dec 1;10(23):7884-95. 25. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10 (12):901-9. 26. Applied biosystem. 27. Identification, Characterization, and Differentiation of Human Prostate Cells.Parmender P. Mehta, Carlos Perez-Stable, Bernard A. Roos, Mehrdad Nadji Methods in Molecular Biology.Vol:137Jan-21-200: 317-335 28. Unopposed c-MYC expression in benign prostatic epithelium causes a cancer phenotype. Williams K, Fernandez S, Stien X, Ishii K, Love HD, Lau YF, Roberts RL, Hayward SW. Prostate. 2005 Jun 1;63(4):369-84. 29. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on a2h1-integrin expression. J Cell Sci 2001;114:386572. 30. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ, Collins AT. CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci 2004;117: 353945. 31.Kleeberger, Wolfram, Bova, G. Steven, Nielsen, Matthew E., Herawi, Mehsati, Chuang, Ai-Ying, Epstein, Jonathan I., Berman, David M. Roles for the Stem Cell Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis Cancer Res 2007 67: 9199-9206. 32. Anchorage-independent culture maintains prostate stem cells. Shi X, Gipp J, Bushman W. Dev Biol. 2007 Dec 1;312(1):396-406. Epub 2007 Sep 29). 33. Oct-4: gatekeeper in the beginnings of mammalian development. Pesce M, Schler HR.Stem Cells. 2001;19(4):271-8. 34. Glycoconjugate expression during embryogenesis and its biological significance. Bruce A. Fenderson, E. M. Eddy, Sen-Itiroh Hakomori.BioEssays Volume12, Issue4, Date:April 1990, Pages:173-179 35. Bonkhoff, H, Remgerger, K (1996). Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: a stem cell model. Prostate 28:98-106. 36. Patrawala L, Calhoun-Davis T, Schneider-Broussard R, Tang DG. Hierarchical organization of prostate cancer cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells. Cancer Res 2007; 67:6796- 6805. 37. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL. CD44+ CD24(-) prostate cells are early cancer progenitor/ stem cells that provide a model for patients with poor prognosis. Br J Cancer 2008; 98:756-765. 38. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of cultured human prostate cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urol Res 1997;3:6775. 39. Farini D, Puglianiello A, Mammi C, Siracusa G, Moretti C. Dual effect of pituitary adenylate cyclase activating polypeptide on prostate tumor LNCaP cells: short- and long-term exposure affect proliferation and neuroendocrine differentiation. Endocrinology 2003;144: 163143. 40. Jensen JB, Parmar M. Strengths and limitations of the neurosphere culture system. Mol Neurobiol 2006;34:153161. 41. Collins, Anne T., Berry, Paul A., Hyde, Catherine, Stower, Michael J., Maitland, Norman Prospective Identification of Tumorigenic Prostate Cancer Stem Cells Cancer Res 2005 65: 10946-10951. 42.Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127:469-480. moment. J Pathol 2008; 214:3-9. 43.Lo Celso C, Prowse DM, Watt FM. Transient activation of beta-catenin signalling in adult mouse epidermis is sufficient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours. Development 2004; 131:1787-1799. 44. Sheng Zhou, John D. Schuetz, Kevin D. Bunting, Anne-Marie Colapietro, Janardhan Sampath, John J. Morris, Irina Lagutina, Gerard C. Grosveld, Mitsujiro Osawa, Hiromitsu Nakauchi Brian P. Sorrentino . The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype, Nature Medicine 7, 1028 1034 (2001). 45. L. Patrawala, T. Calhoun and R. Schneider-Broussard et al., Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2 cancer cells are similarly tumorigenic, Cancer Res 65 (2005), pp. 62076219. 46. W.J. Huss, D.R. Gray and N.M. Greenberg et al., Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells, Cancer Res 65 (2005), pp. 66406650. Appendix Protocols and Supporting documents Protocol: Purification of Total RNA from Animal Cells This protocol requires the RNeasy Mini Kit. Determining the correct amount of starting material It is essential to use the correct amount of starting material in order to obtain optimal RNA yield and purity. The minimum amount is generally 100 cells, while the maximum amount depends on: The RNA content of the cell type The RNA binding capacity of the RNeasy spin column (100 g RNA) The volume of Buffer RLT required for efficient lysis (the maximum volume of Buffer RLT that can be used limits the maximum amount of starting material to 1 x 107 cells) RNA content can vary greatly between cell types. The following examples illustrate how to determine the maximum amount of starting material: COS cells have high RNA content (approximately 35 g RNA per 106 cells). Do not use more than 3 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. HeLa cells have average RNA content (approximately 15 g RNA per 106 cells). Do not use more than 7 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. NIH/3T3 cells have low RNA content (approximately 10 g RNA per 106 cells). The maximum amount of starting material (1 x 107 cells) can be used. If processing a cell type not listed and if there is no information about its RNA content, we recommend starting with no more than 34 x 106 cells. Depending on RNA yield and purity, it may be possible to increase the cell number in subsequent preparations. Do not overload the RNeasy spin column, as this will significantly reduce RNA yield and purity. Counting cells is the most accurate way to quantitate the amount of starting material. As a guide, the number of HeLa cells obtained in various culture vessels after confluent growth is given in Table 5 SuperScriptTM III First Stand Synthesis System for RT-PCR Amplification of Target cDNA The first-strand cDNA obtained in the synthesis reaction may be amplified directly using PCR. We recommend using 10% of the first-strand reaction (2 l) for PCR. However, for some targets, increasing the amount of firststrand reaction up to 10 l in PCR may result in increased product yield. We recommend the following DNA polymerases (for ordering information, : Platinum Taq DNA Polymerase provides automatic hot-start conditions for increased specificity and sensitivity. It is recommended for targets up to 4 kb. Platinum Taq DNA Polymerase High Fidelity provides increased fidelity and higher yields for targets up to 15 kb. Platinum Pfx DNA Polymerase possesses a proofreading 3 to 5exonuclease activity and provides maximum fidelity for PCR. It is recommended for targets up to 12 kb. Protocol for DNA Amplification A Master mix of reagents (water, dNTPs, Primers and Enzymes) for all samples can be prepared fast and then aliquoted to individual tubes. Magnesium chloride and the template DNA are then added. Using such mixes would reduce pipetting loss, increase accuracy and reduce the number of transfers. Perform Amplification in Applied Biosystem PCR tube. DNA may stick to the plastic and since the nuclease are found on the surfaces sterile siliconized tubes and tips are used.
Wednesday, May 6, 2020
Essay about The Problems with Fracking - 2005 Words
No Fracking Way Imagine a world where fresh and clear water was a luxury. Imagine water so contaminated with chemicals that every plant it comes into contact with dies. As the trees begin to die, oxygen levels drop. As the vegetation dies, wildlife begins to die out. The polluted water which flows through the ground into wells causes instant contamination. As the water flows out of the sink, one can strike a match and light the liquid on fire. Showering in these chemicals is out of the question. Fresh water has become a comfort, rather than a given. Could planet Earth survive this existence? If hydraulic fracturing, otherwise known as fracking, were deemed legal, this question may be put to the test. Fracking is a process in which†¦show more content†¦While vertical wells do yield gas, they are mainly used as a base to connect several horizontal wells, which is where the money lies in the industry. After drilling, about â€Å"2 million to 10 million gallons of water [is used] to extract t he gas†(Marsa 3-4). However, high pressured water alone will not break away the shale rock, therefore sand is added to enable further fracturing. The controversial issue fueling the debate is the third substances added to the water which allow the natural gas to escape for collection. â€Å"A cocktail of friction-reducing lubricants [are used] to make the water slick enough to slide through the pipes swiftly†(Marsa 4). A geochemist by the name of Tracy Bank conducted a study at SUNY Buffalo which concluded that the lubricant contained an abundance of toxic metals, â€Å"including uranium, barium, chromium, zinc and arsenic†(Marsa 2). This is just a short list of the negative compounds used in fracking. It is likely that the public will never get the full story as to the composition of the lubricants, as major fracking companies refuse to release that information, â€Å"claiming that doing so would reveal trade secrets†(Rahman 1). So where do these cont aminants end up? After reaching the surface, the waste is emptied into tanks for storage. However, sometimes ponds are also used to hold the pollutants, therefore releasing the harmful toxins into runoffs. Once the gas hasShow MoreRelatedFracking : Too Many Fracking Problems1631 Words  | 7 PagesToo Many Fracking Problems â€Å"Fracking ensures that the age of oil-and it s princely hydrocarbon cousin, the natural gas molecule-will not end because we have run out of fossil fuels. But it may end because burning these wonderful fuels puts the planet farther down a path we don t want to head down†. Fracking, or hydraulic fracturing, is a petroleum mining method to reach remote gas under water that is located in the crust of the earth. Fracking uses a blend of water, sand, and chemicals. HydraulicRead MoreNatural Gas : A Sustainable And Environmentally Friendly Gases1247 Words  | 5 Pagesseventy percent fewer emissions than coal and twenty percent fewer emissions than oil . Natural gas would also be much cheaper than oil per gallon and is environmentally sustainable; however, fracking, the process of extracting the natural gas, may not be as environmentally stable as many would think. Fracking is the process of drilling and injecting fluid at high pressure in order to crack shale rocks to extr act natural gas. The water is mixed with sand and other toxic chemicals to help the processRead MoreThe Need to Stop Fracking616 Words  | 3 Pagesfracking is the process of getting natural gas from from shale rock deep into the ground. to get the natural gas we have to use a thing called horizontal drilling, horizontal drilling allows us to go deep into the ground and injected high pressure fracking fluids into the shale area and when they have the cracks in the ground for the oil to go through and they put sand to hold open the cracks and keep them open this is the process of fracking. Tell the recipient of your letter why you chose to shareRead MoreFracking : Fracking And Fracking1524 Words  | 7 Pages Hydraulic Fracturing Research Paper Hydraulic Fracturing (also commonly known as fracking) is a process used to extract natural gasses deep within the earth. This is done by drilling vertically into the ground until the desired depth; then drilling horizontally; and pumping millions of gallons of water, sand, and other chemicals into the drill at a high pressure to create fissures through which the gas can escape. Currently, hydraulic fracturing is extensively used in the United States in orderRead MoreIs Fracking Safer : Wastewater Injections Cause Human Made Earthquakes, But The Risk Can Be Reduced1142 Words  | 5 PagesAnnotated Bibliography Arizona State University. (2016, September 22). Research finds way to make fracking safer: Wastewater injections cause human-made earthquakes, but the risk can be reduced. ScienceDaily. Retrieved February 24, 2017 from www.sciencedaily.com/releases/2016/09/160922150659.htm The Arizona State University effectively relays the information from a research done to evaluate the use of fracking techniques in relation to the Texas earthquakes experienced in May of 2012. The research doneRead MoreThe Need, Risks And Impacts1396 Words  | 6 PagesFRACKING-â€Å"The Need, Risks and Impacts†Hydraulic Fracking, which is the extraction of natural gas which was earlier protected, has become a major problem today. It is an environmental as well as a health hazard. The large firms which are linked to fracking have tried to justify fracking by citing that the benefits of it outweigh the harm that it might potentially cause. But before buying that argument, it is important for us to understand if the idea of fracking is really good for a long term scenarioRead MoreFracking And Its Wastewater Disposal1489 Words  | 6 PagesDat Ninh T. Drosselmeyer Engl 1113 – 088 14 November 2016 1393 words Fracking and its wastewater disposal are threatening human’s life In recent years, there has been an increasing concern about whether or not should factories keep using Fracking as their main method to extract oil and gas from the underground. Fracking, or hydraulic fracturing can be defined as the process of drilling down into the Earth and injecting high-pressurized water mixture into the ground, creating cracksRead MoreFracking Should Not Be Banned1526 Words  | 7 PagesFracking is a pressurized, chemically treated mixture of water and sand used to release and extract natural gas and petroleum from shale rock. The process involves a well drilled vertically to the desired depth, then turns ninety degrees and continues horizontally for thousands of feet into the shale believed to contain the trapped natural gas. A mix of water, sand, and various chemicals are pumped into the well at high pressure in order to create fissures in the shale through which the gas can escapeRead MoreRhetorical Situations And Their Constituents Essay1588 Words  |à ‚ 7 Pageswill choose them over a different company. Rhetoric can be found all over the news and while doing research I came upon the article â€Å"Are We Fracking Away our Health?†To analyze the rhetoric of this article, we must look at the exigence, audiences, constraints, and any unforeseen ramifications of the article. Exigence defined by Grant-Davie is â€Å"some need or problem that can be addressed and solved through rhetorical discourse†(351). The exigence of an article can be answered by using three questions:Read MoreA Brief Look at Fracking1383 Words  | 6 Pagesnumber one source of America’s constant need for gas. Most of that production increase has come about to the growing need of hydraulic fracturing, also known as â€Å"fracking†, which is a process used to release oil or gas from underground formations that are otherwise too hard to mine with other tools. Over the past few years, advances in fracking technology have made huge reserves of natural gas in America economically recoverable. According to the Energy Information Administration, shale gas plays, or
George Gittoes Free Essays
George Gittoes Case Study George Gittoes, born 1949 in Rockdale Sydney, NSW has trained at, The Yellow House, Sydney, NSW 1970-1971, Art Students’ league, New York, USA and The University of Sydney in 1968. George is an artist of many talents, he is known as a ceramist, screen artist, performance artist, printmaker, draughtsman, painter and photographer. Gittoes is also a filmmaker, known well for his documentary Soundtrack to War filmed throughout 2003-2004. We will write a custom essay sample on George Gittoes or any similar topic only for you Order Now His documentary captures authentic recounts from individuals who have experienced or are experiencing the war in Iraq. In this quote George explains why he partakes in works about war and humanitarian issues in today’s world, â€Å"Why do I do it? As far as choosing the roads I have traveled, I have this instinct that if I get comfortable, the work will lose its ‘sting’, so I go out of the comfort zones and into the wilderness to find my art. In the past it was the natural world where predators fed on gentler creatures. In the contemporary context, I go alone into a different kind of human wilderness – Rwanda, Bosnia, Afghanistan, Iraq – not to contemplate nature, but the basics of humanity†¦ George Gittoes (http://en. wikipedia. org/wiki/George_Gittoes) George Gittoes artwork, white earth is oil on canvas portrays political corruption and how youth were immersed in the propaganda of Nazi Youth. On the work, the boy’s ears are distorted, expressing the impossibility of closing them now and not listening to the lies he is immersed in. By using blue and ye llow dividing lines in the background it separates the boy from the two official behind him giving orders and leading him. Gittoes witnessed an Afrikaner-Weerstands Beweging (AWB) rally during his visit to South Africa in 1994, there he saw a 15year old boy immersed in the propaganda of Nazi Youth. Whilst being pestered by photographers, Gittoes sympathises for the boy, as he recounts the rape and tortured. The boy in the work is too young to fully understand the political corruption circling around him and was stuck between being used by the AWB and being tortured by international press. You can relate to why the boy has shut his eyes, to lock out the controversy, but it is near impossible to shut his ears to the hate propaganda being inflicted on him by Terre Blanch (the figure to the right as explained by George). One side of the boy’s body is unnatural enlarged as if expressing his sway toward Terre and away from the other figure. If this is what is happening it explains why the other figure has one hand raised over his face in despair. This explains the world now and the world almost 20 years ago, as one of propaganda, corruption and the influences of political figures. The artwork White Earth explains in the title the racism that is ever so abundant in our world even to today. This belief of an all white country is thrust upon many, especially the young and naive like the boy being harassed in South Africa by corrupt political leaders or figure of authority. Gittoes is renowned about the way he creates work s by inspiration of his life experiences. He has a great deal of passion for art and humanity to be an eyewitness to the suffrage of mankind throughout the world is carried in his work. The social class portrayed in this painting is high and low. The political leader and dictator Terre Blanch is high in social class, whereas the boy may be lower in class making him an easy target for manipulation and subject to receiving hate propaganda from authority figures. The meanings shown in this is the meaning or influences, that what you here you are persuaded to believe even if you shut your eyes they cannot be blocked out. George Gittoes works are controversial but inspiring based on the true-life events that he witnesses he tries to portray, the emotions, belies, and stories through elements and aspect of the artwork. This artwork was well received by some but not all as some don’t believe in the Nazi youth propaganda and support Terre Blanch’s views. In conclusion this artwork ‘White Earth’ by George Gittoes is an in-depth representation of corruption, racism and power held by those few people trust and look to-political leaders. George has captured what I assume many are trying to get away from, hearing about hate propaganda, we can all shut our eyes but not many can shut their ears as well. How to cite George Gittoes, Papers
George Gittoes Free Essays
George Gittoes Case Study George Gittoes, born 1949 in Rockdale Sydney, NSW has trained at, The Yellow House, Sydney, NSW 1970-1971, Art Students’ league, New York, USA and The University of Sydney in 1968. George is an artist of many talents, he is known as a ceramist, screen artist, performance artist, printmaker, draughtsman, painter and photographer. Gittoes is also a filmmaker, known well for his documentary Soundtrack to War filmed throughout 2003-2004. We will write a custom essay sample on George Gittoes or any similar topic only for you Order Now His documentary captures authentic recounts from individuals who have experienced or are experiencing the war in Iraq. In this quote George explains why he partakes in works about war and humanitarian issues in today’s world, â€Å"Why do I do it? As far as choosing the roads I have traveled, I have this instinct that if I get comfortable, the work will lose its ‘sting’, so I go out of the comfort zones and into the wilderness to find my art. In the past it was the natural world where predators fed on gentler creatures. In the contemporary context, I go alone into a different kind of human wilderness – Rwanda, Bosnia, Afghanistan, Iraq – not to contemplate nature, but the basics of humanity†¦ George Gittoes (http://en. wikipedia. org/wiki/George_Gittoes) George Gittoes artwork, white earth is oil on canvas portrays political corruption and how youth were immersed in the propaganda of Nazi Youth. On the work, the boy’s ears are distorted, expressing the impossibility of closing them now and not listening to the lies he is immersed in. By using blue and ye llow dividing lines in the background it separates the boy from the two official behind him giving orders and leading him. Gittoes witnessed an Afrikaner-Weerstands Beweging (AWB) rally during his visit to South Africa in 1994, there he saw a 15year old boy immersed in the propaganda of Nazi Youth. Whilst being pestered by photographers, Gittoes sympathises for the boy, as he recounts the rape and tortured. The boy in the work is too young to fully understand the political corruption circling around him and was stuck between being used by the AWB and being tortured by international press. You can relate to why the boy has shut his eyes, to lock out the controversy, but it is near impossible to shut his ears to the hate propaganda being inflicted on him by Terre Blanch (the figure to the right as explained by George). One side of the boy’s body is unnatural enlarged as if expressing his sway toward Terre and away from the other figure. If this is what is happening it explains why the other figure has one hand raised over his face in despair. This explains the world now and the world almost 20 years ago, as one of propaganda, corruption and the influences of political figures. The artwork White Earth explains in the title the racism that is ever so abundant in our world even to today. This belief of an all white country is thrust upon many, especially the young and naive like the boy being harassed in South Africa by corrupt political leaders or figure of authority. Gittoes is renowned about the way he creates work s by inspiration of his life experiences. He has a great deal of passion for art and humanity to be an eyewitness to the suffrage of mankind throughout the world is carried in his work. The social class portrayed in this painting is high and low. The political leader and dictator Terre Blanch is high in social class, whereas the boy may be lower in class making him an easy target for manipulation and subject to receiving hate propaganda from authority figures. The meanings shown in this is the meaning or influences, that what you here you are persuaded to believe even if you shut your eyes they cannot be blocked out. George Gittoes works are controversial but inspiring based on the true-life events that he witnesses he tries to portray, the emotions, belies, and stories through elements and aspect of the artwork. This artwork was well received by some but not all as some don’t believe in the Nazi youth propaganda and support Terre Blanch’s views. In conclusion this artwork ‘White Earth’ by George Gittoes is an in-depth representation of corruption, racism and power held by those few people trust and look to-political leaders. George has captured what I assume many are trying to get away from, hearing about hate propaganda, we can all shut our eyes but not many can shut their ears as well. How to cite George Gittoes, Papers
Saturday, April 25, 2020
Neurophysiology and Learning Essay Example
Neurophysiology and Learning Essay Neurophysiology and Learning September , 2010 For the survival and progression of life as we know it, humans and non humans must rely on the fundamental aspects of learning. Learning is all around us, we experience it in our everyday lives, sometimes without even being aware of it. Theories of learning were introduced centuries ago, and being so important and of much significance in Psychology, they are continuously studied, revised and improved. A popular branch of the study of learning, Neurophysiology, encompasses how body and brain activities are synchronized and complement each other in order to bring about learning. In a great attempt to uncover the many dimensions of learning, psychologists studied profusely what the mind might be capable of. Their main desire was to separate mind and body, with the hopes of understanding how these two elements complemented each other (Hergenhahn, Olson, 2005). Rene Descartes, a theorist, performed a study in the areas of physiology and neuroscience. He wanted to understand why it was that despite having two separate eyes, organisms are only able to see one object in their field of vision. Descartes believed it was the â€Å"physiological unification of the binocular stimulation in the optic chiasma†(Harftfield, 1998, p 389). It was in this study the he concluded that the stimuli found in this optic chiasma yielded to the different sides of the brain. Descartes’ research led to the study of the physiological nature of the mind and body. Focusing all exercises on the body’s nervous system, Sir Charles Sherrington became a great contributor to Neurophysiology in its early stages of study. We will write a custom essay sample on Neurophysiology and Learning specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Neurophysiology and Learning specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Neurophysiology and Learning specifically for you FOR ONLY $16.38 $13.9/page Hire Writer His work on the brain’s neuron processes unveiled how certain areas of the brain relate and work with each other to endorse the process of learning, the unearthing of â€Å"the anatomical concepts of the neuron and synapse†(Eccles, J. , 1957, p 218). Sherrington’s achievements led to new advances in the field of neurophysiology. Without the initial doubt and wonder of how the mind and body work separately and together, theorists, scientists, psychologists, and even philosophers would have not pursued the study of neuroscience and physiology that analyzed earlier beliefs of human behavior, brain function, and the nervous system. Viewed as a new branch of psychology, and perhaps, a new science, Neurophysiology has opened the door to understanding the relationship between mind and body, which brings about the neuroscientific research promoting the progression and survival of the human species (Hergenhahn, Olson, 2005). The study of neurophysiology is linked to the theories of learning in more ways than one. How organisms relate to their environment and are able to carry out learning processes are basically what neurophysiology attempts to explain. There are internal and external factors, as well as biological and environmental ones that may profoundly affect how organisms learn and apply such knowledge. A famous neuroscientist popularly represented in the study of learning is Donald Olding Hebb. After much observation and study of the human brain, Hebb concluded the following: 1. The brain does not act as a simple switchboard, as the behaviorists and associationists had assumed. If it did, destroying large amounts of brain tissue from the frontal lobes would have been more disruptive. 2. Intelligence comes from experience and, therefore, is not genetically determined. . Childhood experiences are more important in determining intelligence than adult experiences (Hergenhahn, Olson, 2005, p 362). Hi first observation was meant to be taken as literally as it sounds. The brain, as he examined, is an extraordinary organ that is able to sustain various atrocities without necessarily losing all functions. Hebb confirmed his belief tha t it was through experience that we gained intelligence, that organisms actually learned. Organisms are not born intelligent, they learn through sensory events, through trial and error, among many other ways. And lastly, Hebb concluded through more experimenting and observation that childhood experiences are more important than adult experiences. Some early childhood learning cannot be undone as an adult. Children placed in enriched environments demonstrate a higher intelligence than those in restricted environments (Hergenhahn, Olson, 2005). Therefore, it is extremely important to study and debate what are the best policies for the educational environment. Is it best to include every possible child into the learning system? Or will that damage the learning process of those advanced students? These questions have been debated for many years and unfortunately, there is no possibility of including all children into the same learning environment without holding back those at a more advanced level. Hebb’s work in neurophysiology paved the way for more research on the environmental effects of learning theories. Since the study of neurophysiology pairs the brain’s messages transmitted to the body to attain a physical behavior, an acute link is born. An organism’s brain reactions and bodily functions are controlled by the central nervous system, including biological needs, such as having to attend to the washroom. Not all nervous systems are alike, some react to certain stimuli while others remain oblivious to it (McCormick, Connors, Lighthall, Prince, 1985). This may explain why certain students are faster learners than others. It is incorrect to believe that student who does not respond as quickly as his classmate is plain lazy or dumb. Why this occurs is what makes individuals unique to the environment. The a principal focal point in neurophysiology is the central nervous system, arranging the transmission of brain’s messages to all parts of an organism’s body. These neural events, or chemical messages, are called neurotransmitters, and are responsible for all brain function (Hergenhahn, Olson, 2005). In turn, the nervous system is accountable for all interactions among the brain and the physical body. Without the central nervous system, organisms would lack the capacity to learn and prosper. The brain’s neurotransmitters are vital not only human behavior, but to neurophysiology entirely. This explains why some organisms are quicker to react and understand than other. Their neurotransmitters work at a much faster pace and therefore appear to be smarter and even more enthusiastic. Interestingly enough, the conscious and the body correlate so as it integrate the bodily and cerebral processes to happen (Carlson, 2005). An organism’s reaction to the surrounding environment as well as the adjustment to the continuous changes in such environment relies on various aspects. When neurons excite each other in order to communicate, is quite possibly how scientists discovered the way the nervous system is able to control physical behavior (Carlson, 2005). It is through this important communication process that neurons enable the brain to â€Å"gather sensory information, make plans, and initiate behaviors†(Carlson, 2005, p 48). The communication between the mind (central nervous system) and the body allow for all organisms to absorb information, process it and continuously apply in every day. Hence, neural communication commences the process of learning. The nature of fear has evolved humans to distinguish the stimulating factors that occur in a potentially dangerous place. People (and many animals as well) learn to familiarize these factors and in turn act according to what they know they should do, based on prior experiences (Hergenhahn, Olson, 2005). Thus, organisms learn through the nature of fear, when and how to avoid similar circumstances. Fear presents itself in all sort of ways and forms. A child or teenager, for example, may associate bad grades with a spanking, a tedious lecture or punishment. They will in turn fear bad grades and study in order to achieve high marks. Sensing fear will most likely send organisms into survival mode and what one knows about the situation one is in will be used to either avoid or deal with the fearful circumstance. Fear and learning are interconnected as part of the survival mode most organisms are born with. As Neil R. Carlson once wrote, â€Å"learning produces changes in the way we perceive, act, think, and feel†(Carlson, 2005, p 361), creating the process of learning an infinite experience. Motor learning, for example, is one of many central learning processes, involving adjustments in the neural circuits that are in charge of the body’s actions. Still, sensory events and stimuli are what conduct motor learning (Carlson, 2005). The most comprehensive form of learning, associated with the nervous system, the neural communication and behavioral reaction to stimuli is perhaps relational learning (Hergenhahn, Olson, 2005). As a result, the brain and the central nervous system become fundamental approaches of behavior and learning in a person. Any type of obstruction or injury to either of these areas can and most likely will greatly affect motor skills and possibly alter human behavior as well as learning. Just as seen on TV, hideous car accidents may send a person to physical rehabilitation. How much patience, persistence, perseverance and effort the person puts in may act as the overall difference in returning to as much normality as the rehabilitation allows. Therefore, the importance of discovering new ways to potentially correct or undo any damage to the brain or the central nervous system is vital for the survival of a human in critical condition. In order for behavior to occur, neurons need to communicate and convey messages. Nonetheless, objects seen in the environment where an individual is found, has a an arousing affect that leads to the formation of cell assemblies (Hergenhahn, Olson, 2005). Hebb explained how such phase sequences are continuously changed by what we observe and identify. So, neurotransmitters fuel different learning and behavioral patterns predisposed by our surroundings, and our surroundings in turn have an effect on neural function. Hebb’s theory culminates the idea that learning is an internal and external process in relation to the environment we are in. Equally, the circumstances humans might find themselves in are ever-changing, and learning becomes an intricate process that should never ceases to exist. What we learn today may be the ticket for a better tomorrow. How we apply what we know, what we have learned, both inside and out of the classroom and work place will be the difference between a mediocre life and great success. Because the environment changes constantly, humans need to change along with it. How we adapt to these changes is part of the learning process. If we know wearing a warm jacket, gloves and a wool hat will keep us from getting cold, but we choose to wear shorts and a t-shirt, the human race would cease to exist due to lack of change. Nowadays, we have all sorts of information that after much research and experimentation, guide us to a brighter future. Nonetheless, the importance of continued study is perhaps the only way we can guarantee survival. A particularly interesting concept brought about decades ago, which has evoked much research and exciting discoveries is that of dichotomania, which is â€Å"the attempt to find [bilaterality]†¦and explain their existence in terms of how the cerebral hemispheres process information†(Hergenhahn, Olson, 2005, p 391). The strong belief the each half of the brain functions differently has been a topic of debate and thus of much research as well. If there was even a slight possibility that a certain side of the brain was more important that the other, could a person working that side of brain more than the other be more intelligent than someone working the less important side? How we define important and intelligent makes all the difference here. Some individuals might be born with the tendency to work one side more that the other, true, but what we do with what we know is what makes the difference. After much experimental research on brain function, scientists came to discover the various aspects found in the two halves of the brain. However, despite these findings, it is incorrect to assume that any half of the brain functions as a whole brain in itself. The following table â€Å"reflect[s] the two kinds of hemispheric intelligence†(Hergenhahn, Olson, 2005, p 391): Left Hemisphere Intelligent Convergent Realistic Intellectual Discrete Directed Rational Historical Analytical Successive Objective Atomistic Right Hemisphere Intuition Divergent Impulsive Sensuous Continuous Free Intuitive Timeless Holistic Simultaneous Subjective Gross The analytical, left hemisphere dominates the learning of a new language, as well as speech and writing. The right hemisphere, on the other hand, governs the constructing, touching, feeling aspects of the human being. However, both halves â€Å"perceive, learn and process in the same manner†(Hergenhahn, Olson, 2005, p 392). A free spirited bohemian clearly exercises his right hemisphere more than his left. Just like an studious lawyer exercise his left hemisphere over his right. Both individuals are perceived as different in a rational and irrational sense, nevertheless, both have seen, felt, touched, smelled, learned, perceived, experience, using the same halves of he brain. The lawyer needed to achieve high grades in order to get through law school, and continuously study throughout his competitive career. As a free spirited bohemian, all kinds of art (music, photography, painting, etc) may be of interest and his innate talent is what might make him as successful as the lawyer. How they learn may slightly differ, how and what they learn best differs immensely and makes them un ique. The continuous study of neurophysiology has and will lead many more scientists to research and discover new findings in the clinical realm. Such discoveries are fundamental to the progression and survival of the human body. How much do we really know about the human brain and the nervous system? There are millions of questions still unanswered about how the brain works and how we can achieve higher aptitudes, if we only knew more about how it all works inside our heads. Psychologists, scientists, theorists, among many others, have vast resources unknown to man until several decades ago. The internet for example, stores more information than any library in the world, hence being an essential tool to any researcher. Introducing the central nervous system to a clinical setting allows for doctors all over the world to study our bodies under a microscope. Going into a hospital or clinic for an exam and getting your results within a few weeks is the common norm. The clinical settings permits doctors to properly diagnose patients or clients with all kinds of diseases and disorders that would have been rather impossible without neurophysiology. Chemical imbalances are so popular nowadays because of the great amount of research in the area. Thirty years ago, an student having problems concentrating was probably flunked without hesitation. Such an action is no longer necessary, having discovered the amount of disorders that cause the student to lose or lack the ability to focus on a certain subject. The learning process has since thrived and expanded the universal understanding and knowledge of the mind and body. With all past and present discoveries in neurophysiology, humanity has placed in the important role of continuously researching more medical advancements that will aid the survival of our species. As long as neurophysiology is considered and rendered the appropriate focus in psychology and clinical research, these two will continue their everlasting marriage. Irving Zucker expressed how â€Å"the society’s future and indeed the discipline of physiology depend critically on our ability to adapt, change and grow†(Zucker, 2008, p 3). Will we allow ourselves the chance to study new material and perhaps discover new cures? Is giving up or letting go of a theory or ideal that has yet to be confirmed, the right path to take? These questions can only be answered with proper attention and much consideration. But it is our responsibility as the strongest and most destructive species on the planet, to conserve ourselves and our environment. How we adapt to our ever-changing environment will result in the survival or abomination of humanity. Scientists have learned, through experimental procedures many decades ago, that the study and understanding of neural brain function is what thrusts neurophysiology into the future. The goal to be achieved here is the permanent study of abnormal formations in the central nervous system as well as the brain. To continuously study the photos in the mother’s womb to determine if any such abnormalities have formed. Detecting such atrocities in order to treat newborns decrease the amount of infant mortality. Although clinicians are still far away from being able to treat an unborn child’s weak heart, deprived lung, or a weakening nervous system, such miracles will happen someday. The field of technology excels every single day. How someone’s eyesight can be corrected in a couple of hours used to be something one could only wish for many years ago. The intense curiosity of how our brain and central nervous system worked together for the individual to perceive and behave in its environment led the commencement of neurophysiology. After much experimental research and study of physiology en neuroscience, it was discovered that the mind and body coexist and influence learning as a ever-lasting process. Neurophysiology has become an important and influential part of the study of psychology and past as well as present learning theories and continuous to do so because of it encompasses
Wednesday, March 18, 2020
The Communist Dictatorship in Cuba essays
The Communist Dictatorship in Cuba essays Cuba is a communist dictatorship, with Fidel Castro as the head of state. It does not have an independent judiciary nor does it have free elections. So the people of Cuba would be considered subjects to the country. Fidel Castro led a rebel army to overthrow the Cuban government and achieved victory in 1959. Cuba's communist revolution, with Soviet support, was exported throughout Latin America and Africa during the 1960s, 70s, and 80s. The country is now slowly recovering from a severe economic recession following the withdrawal of former Soviet subsidies, worth $4 billion to $6 billion annually, in 1990. Havana blames its difficulties on the US embargo in place since 1962. Cuba is a multiracial society with a population of mainly Spanish and African origins. The largest organized religion is the Roman Catholic 85%, Santeria 15%, a blend of Protestants, Jewish, Santerian, and native African religions. Roman Catholicism, is the most widely practiced religion in Cuba. Officially, Cuba has been an atheist state for most of the Castro era. However, a constitutional amendment adopted on July 12, 1992, changed the nature of the Cuban state from atheist to secular, enabling religious believers to belong to the Cuban Communist Party (PCC). Cuba is slightly smaller than Pennsylvania with a population of 11,730,400 (October 2002). The labor force is comprised of agriculture 23%, industry 24%, services 53% and they have an unemployment rate of 6%. Industries include sugar, petroleum, food, tobacco, textiles, chemicals, paper and wood products, metals (particularly nickel), cement, fertilizers, consumer goods, agricultural machinery. Cuba like all countries is comprised of many races of people. Ethnic divisions in Cuba include Mulatto 51%, European descent 37%, African descent 11%, and Chinese 1%. Cuba remains racially divided between the white haves and the black and mixed-race have-nots. It is safe to say Cuba is conflictual political cu...
Sunday, March 1, 2020
4 Questions That Will Make You Rage Quit
4 Questions That Will Make You Rage Quit You’ve had it. You can’t face another day at that office with those people. Maybe it’s not as clear-cut as wanting to strangle your boss or disagreeing with your company’s mission. Maybe you just feel bored, or stressed, or unhappy (or all 3!) without really pinpointing why.  Here are four questions you should ask yourself when deciding if it’s time to cut bait and look for a new job.1. Is my work appreciated?What do you mean I need to work harder, I just missed Christmas Eve with my family to work on that report!Morale drops when employees feel like their work is not appreciated by the powers-that-be. A recent Gallup study of employee engagement (defined as feeling invested in your job) showed that in 2014, less than one-third of people polled said they were â€Å"engaged†in their regular job. That’s up slightly from years past, but still- that’s an awful lot of people who don’t feel appreciated and motiv ated in their current roles.Many companies are trying to stem this by offering special employee appreciation events or give bonuses/rewards for excellent work. However, if your boss doesn’t seem to notice or care that you’re working like crazy to support the company’s bottom line, take your skills and experience where they’ll be valued.2. What the heck am I doing here?I’d rather be doing literally anything else–even fighting bears.Purpose is a key motivator of workplace happiness and productivity. If you know your company’s goals and your role in moving those forward, chances are you’ll feel a focused connection to your day-to-day work. However, when those  goals get vague, it can be easy to get caught in a feedback loop of coasting.If you find yourself checking Instagram more than your work email, the culprit could be a lack of direction. The first step should be working with your manager to define priorities and goals- but if you do this and you still feel like most of your day is spent drifting through time-filler tasks and pointless meetings, it might just be time to move on.3. Am I Stuck in the Middle of Nowhere?I have no idea what I’m doing.It can be so demoralizing to realize you don’t have the tools and resources available to do a great job. Maybe your company is in a financial crunch and can’t hire new people. Perhaps your manager just doesn’t have the time or desire to explain what needs to be done.I’ve worked in places where everyone is so caught up in their own endless to-do lists that no one has the time to sit down and effectively plan, execute, and support a project that needed to be finished†¦ a week ago. Chances are, it’s not your fault- but it can feel like it’s on you to fix.Once you’re in a defensive crouch and feeling overwhelmed, it can be really difficult to a) evaluate the situation objectively, and b) ask for the resources you need. If you reach that point and you don’t see your workplace offering any solutions beyond a shrug and a â€Å"get it done,†then it’s definitely time to re-evaluate your future there.4. Is it all about the Benjamins?Not sure if I’m here because the money is good or if I’m here because some money is better than nothing.You’ve probably thought, â€Å"They don’t pay me enough to do this†during one frustrating moment or another. Or maybe you envy people skipping out to enjoy expensive lunches while you eat a PBJ at your desk. It’s always going to be tempting to go find a job that will pay you more than you make now, but it’s also a legitimate reason to be dissatisfied- and ultimately move on to another job.Let’s face it: a fairy godmother is not likely to pop into your life and offer you double your salary for the same job; but if you start to feel like you really are being undervalued in pay and/or benefits, then start looking around. Ask yourself: What salary do people in roles similar to yours make in other companies? Have you made contributions to your team or company that might merit a raise, but have gone unrewarded? If you have reasonable pay expectations and your manager or company is unable (or unwilling) to accommodate that, then you should start thinking about your options.If you identify with any of these (or, goodness forbid, all), then it’s probably time to start putting out feelers in your network, and brushing up that resume. You deserve better!On mobile? Sign in here to view your job matches.
Subscribe to:
Posts (Atom)